08 مايو 2024







Zurich Open Repository and Archive

University of Zurich University Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch






Year: 2022






Alkali therapy protects renal function, suppresses inflammation, and improves cellular metabolism in kidney disease

Pastor Arroyo, Eva Maria ; Yassini, Nima ; Sakiri, Elif ; Russo, Giancarlo ; Bourgeois, Soline ; Mohebbi, Nilufar ; Amann, Kerstin ; Joller, Nicole ; Wagner, Carsten A ; Imenez Silva, Pedro Henrique




Abstract: Chronic kidney disease (CKD) affects approximately 10–13% of the population worldwide and halt- ing its progression is a major clinical challenge. Metabolic acidosis is both a consequence and a possible driver of CKD progression. Alkali therapy counteracts these effects in CKD patients, but underlying mechanisms re- main incompletely understood. Here we show that bicarbonate supplementation protected renal function in a murine CKD model induced by an oxalate-rich diet. Alkali therapy had no effect on the aldosterone–endothelin axis but promoted levels of the anti-aging protein klotho; moreover, it suppressed adhesion molecules required for immune cell invasion along with reducing T-helper cell and inflammatory monocyte invasion. Comparing transcriptomes from the murine crystallopathy model and from human biopsies of kidney transplant recipients (KTRs) suffering from acidosis with or without alkali therapy unveils parallel transcriptome responses mainly associated with lipid metabolism and oxidoreductase activity. Our data reveal novel pathways associated with acidosis in kidney disease and sensitive to alkali therapy and identifies potential targets through which alkali therapy may act on CKD and that may be amenable for more targeted therapies.




DOI: https://doi.org/10.1042/cs20220095




Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-218512

Journal Article Published Version










The following work is licensed under a Creative Commons: Attribution-NonCommercial-NoDerivatives 4.0 In- ternational (CC BY-NC-ND 4.0) License.




Originally published at:

Pastor Arroyo, Eva Maria; Yassini, Nima; Sakiri, Elif; Russo, Giancarlo; Bourgeois, Soline; Mohebbi, Nilufar; Amann, Kerstin; Joller, Nicole; Wagner, Carsten A; Imenez Silva, Pedro Henrique (2022). Alkali therapy protects renal function, suppresses inflammation, and improves cellular metabolism in kidney disease. Clinical Science, 136(8):557-577.

DOI: https://doi.org/10.1042/cs20220095
























Research Article

Alkali therapy protects renal function, suppresses inflammation, and improves cellular metabolism in kidney disease

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Eva Maria Pastor Arroyo1,2, Nima Yassini1,3, Elif Sakiri3, Giancarlo Russo4,5, Soline Bourgeois1,2,

Nilufar Mohebbi2,6, Kerstin Amann7, Nicole Joller3, Carsten A. Wagner1,2 and

Pedro Henrique Imenez Silva1,2



1Institute of Physiology, University of Zurich, Zurich, Switzerland; 2National Center of Competence in Research, NCCR Kidney.CH, Switzerland; 3Institute of Experimental Immunology, University of Zurich, Zurich, Switzerland; 4Functional Genomics Center Zu¨ rich, University of Zu¨ rich and ETH Zurich, Zurich, Switzerland; 5EMBL Partner Institute for Genome, Editing Life Science Center, Vilnius University, Vilnius, Lithuania; 6Division of Nephrology, University Hospital Zurich, Zurich, Switzerland; 7Department of Nephropathology, Institute of Pathology, University Hospital Erlangen, Friedrich-Alexander-University Erlangen-Nu¨ rnberg, Erlangen, Germany

Correspondence: Pedro Henrique Imenez Silva (pedrohenrique.imenezsilva@uzh.ch)





Chronic kidney disease (CKD) affects approximately 10–13% of the population worldwide and halting its progression is a major clinical challenge. Metabolic acidosis is both a con- sequence and a possible driver of CKD progression. Alkali therapy counteracts these ef- fects in CKD patients, but underlying mechanisms remain incompletely understood. Here we show that bicarbonate supplementation protected renal function in a murine CKD model induced by an oxalate-rich diet. Alkali therapy had no effect on the aldosterone–endothelin axis but promoted levels of the anti-aging protein klotho; moreover, it suppressed adhesion molecules required for immune cell invasion along with reducing T-helper cell and inflamma- tory monocyte invasion. Comparing transcriptomes from the murine crystallopathy model and from human biopsies of kidney transplant recipients (KTRs) suffering from acidosis with or without alkali therapy unveils parallel transcriptome responses mainly associated with lipid metabolism and oxidoreductase activity. Our data reveal novel pathways associated with acidosis in kidney disease and sensitive to alkali therapy and identifies potential tar- gets through which alkali therapy may act on CKD and that may be amenable for more targeted therapies.









Received: 09 February 2022

Revised: 24 March 2022

Accepted: 07 April 2022

Accepted Manuscript online: 07 April 2022

Version of Record published: 21 April 2022

Introduction

Chronic kidney disease (CKD) affects more than 10–13% of the world population and causes excessive morbidity and mortality when progressing to end-stage kidney disease (ESKD) [1,2]. There is no effec- tive therapy that is able to completely halt CKD progression while several therapies aim at ameliorating symptoms and consequences of CKD as well as at slowing down progression [1]. Overt chronic metabolic acidosis is a common feature in late stages of CKD and affects most patients. While early CKD phases are not normally characterized by overt metabolic acidosis, eubicarbonatemic acidosis may develop defined by subclinical acid retention [3–6]. Declined kidney function impairs the capacity to excrete acid and consequently compromises reabsorption and de novo generation of bicarbonate. Multiple studies have suggested that metabolic acidosis is also a driver of CKD progression and experiments in rodents have shown that metabolic acidosis can reduce kidney function or worsen an established kidney injury [7–11]. Therefore, both chronic conditions may form a vicious cycle leading to ESKD. Local inflammation and hypoxia, common to kidney diseases of different etiologies, can also cause local acidification [12] prior to any detectable changes in systemic acid–base status.

Mechanisms underlying the detrimental effects of acidosis on CKD progression have been proposed. Ammonium accumulation in the renal interstitium triggering the alternative complement pathway [13],




or local acid retention (H+) leading to higher production of pro-fibrotic and hypertension-inducing hormones, such as aldosterone, endothelin, and angiotensin-II [3,14]. Both mechanisms would be ultimately responsible for progres- sive loss of kidney function. Alkali therapy could slow these mechanisms by reducing both ammonium and acid retention. Evidence demonstrating that these pathways interact with alkali therapy come mainly from studies using

partially nephrectomized rats and cystic kidney models [15]. Additional mechanisms that may contribute to the ef- fects of alkali therapy are direct metabolic effects of citrate [16] or the renoprotective functions of α-klotho which is sensitive to bicarbonate supplementation [17]. Also, stimulation of a cholinergic anti-inflammatory immune re- sponse by oral bicarbonate supplementation has been demonstrated but its relevance to kidney diseases has not been addressed to date [9].

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Alkalinizing agents may interrupt the acidosis–CKD vicious cycle and slow disease progression. Whether alkaliniz- ing therapies act also independent of the correction of local (renal tissue) and/or systemic acidosis remains unknown. Despite the progress made in recognizing the clinical benefits of alkali therapy, the molecular and cellular mode of action has remained incompletely understood. The identification of pathways contributing to the beneficial effects of alkali is necessary to develop targeted and more powerful therapies to halt CKD progression. In the present study, we show that (1) alkali induces a strong immunomodulatory effect in a crystalline nephropathy mouse model, and

(2) immune responses and tubular cell metabolism are among the pathways targeted by alkali therapy in human and mouse transcriptomes.




Materials and methods

Oxalate nephropathy and alkali therapy

Male 10-week-old C57BL/6JRj mice (Janvier, France) were subjected to 3 days of adaptation with calcium-free diet (irradiated S7042-E005S, Ssniff Spezialdia¨ten GmbH, Soest, Germany), followed by 10 days of induction phase with either calcium-free diet or 0.67% oxalate in calcium-free diet (irradiated S7042-E010), named here as control and crystal nephropathy group, respectively, as described in [18]. Afterwards, mice underwent a recovery phase, in which both diets were replaced with a standard diet for 4 weeks (3433, Kliba, Kaiseraugst, Switzerland). A total of 0.2 M NaHCO3 in autoclaved water was provided ad libitum either from the first day of nephropathy induction (prophy- lactic alkali therapy) or from the first day of recovery (therapeutic alkali therapy) until the time of killing. Additional groups drank normal autoclaved water (untreated) or 0.2 M NaCl. Two mice in the 0.2 M NaCl group were killed (due to reaching the humane endpoint) in the third week of recovery. We collected organs, but not urine from an- imals killed in earlier time points and included their data in the study. Animals that reached humane endpoints in the induction period or in the first week of recovery were excluded from the study (one from the NaCl group on the fourth day of recovery and two from the respective therapeutic alkali therapy group, on the tenth day of induction and second day of recovery). Mice were single-housed three times in metabolic cages: during the 4 days of nephropa- thy induction; on the fourth and fifth recovery days; and the last 48 h before killing. Urine was collected under oil over the last 24 h of each metabolic cage housing period, and body weight, food and water intake, and urine volume were recorded. We noticed in pilot studies that lower intragroup variability was achieved when oxalate nephropathy induction was performed in metabolic cages. Three percent isoflurane anesthetized mice were killed via exsanguina- tion followed by cervical dislocation, and plasma and kidneys were collected. All animal experimentation was carried out at the University of Zurich (Zurich, Switzerland) according to procedures approved by the Veterinary Office of Canton of Zurich Committee on Animal Research.




Human data

We performed RNA extraction from 22 kidney transplant biopsies including 9 biopsies from kidney transplant re- cipients (KTRs) with metabolic acidosis (defined as blood bicarbonate < 22 mmol/l), 9 biopsies from KTRs without metabolic acidosis, and 4 biopsies from KTRs with acidosis and receiving alkali therapy. Additionally, six control kid- neys were analyzed. Full RNA-sequencing analysis of all biopsies was performed [19]. Human studies were approved

by the ethics committee of the Kanton Zurich under the number KEK 2019-00393 and all subjects provided written informed consent.




Urinary and plasma data

Urinary creatinine, urea, magnesium, calcium, sodium, potassium, total protein, and ammonium, and plasma cre- atinine and urea were measured using a UniCel® SYNCHRON® DxC 800 Synchron Clinical System (Beckman Coulter). Urinary NGAL (Lipocalin-2), urinary endothelin 1, and urinary and plasma aldosterone were measured with ELISA kits strictly following manufacturers’ recommendations (respectively, Mouse Lipocalin-2/NGAL, Cat




No. MLCN20, and Endothelin-1 Quantikine ELISA Kit, DET100, both R&D Systems, MN, U.S.A., and Aldosterone ELISA kit, ADI-900-173, Enzo Life Sciences). Blood pH, bicarbonate, urea, sodium, and chloride were measured with an epoc Blood analysis System (Siemens, Switzerland) using ∼100 µl blood collected from the retro-orbital plexus.

Histology

One half of kidney was immersed in 4% paraformaldehyde (PFA in PBS) at room temperature overnight and em- bedded in paraffin or optimal cutting temperature (OCT, Cellpath, U.K.). Kidney sections were prepared and stained for Hematoxylin and Eosin (H&E) and van Gieson according to standard protocols. Embedding and staining were provided as a service by the Laboratory for Animal Model Pathology (LAMP, Vetsuisse, University of Zurich).

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Detection of crystal deposition was achieved with images of H&E-stained renal sections (3 mm thick) acquired under polarized light (Leica DMI6000, 20× magnification) and stitched together to create a whole kidney image. In ImageJ, whole kidney images were converted into RGB and the kidneys were manually selected at the section borders (excluding papilla and artefacts within the tissue). Unselected regions were removed, the image was converted into 8-bit, and a threshold for the selected region was set to isolate crystals using an in-house developed macro.

Measurements of the selected region (total area) and area with crystals were exported and used to calculate relative crystal abundance (crystal area/total area).

Histological scoring was performed with the same H&E images used for detection of crystal deposition. Analysis was done in a blinded manner by an experienced renal pathologist (Kerstin Amann) using a semiquantitative scoring system for glomerulosclerosis (score 0–3), acute tubular injury (score 0–3), interstitial fibrosis and tubular atrophy (IFTA in %), the presence (1) or absence (0) of interstitial inflammation, and intratubular oxalate crystals [20].

Western blot analysis

Left kidneys were extracted from isoflurane anesthetized mice, rapidly frozen in liquid nitrogen and kept at −80◦C until protein extraction. Kidneys were lysed and homogenized in ice-cold solution containing 300 mM mannitol, 5 mM EGTA, 12 mM Tris, pH 7.1 with protease inhibitor cocktail tablets (1 tablet/10 ml of solution, cOmplete mini

EDTA free, Roche Diagnostics GmbH, Mannheim, Germany). Total protein concentration was measured by a modi- fied Bradford dye-binding method (Bio-Rad, Hercules, CA, U.S.A.) and proteins were solubilized in Laemmli sample buffer. Gels were loaded with 30 µg of total kidney lysate and Western blotting was performed as previously described [21]. The primary antibodies were: mouse anti-Vimentin (1:2000, MAS-11883, Invitrogen, Maryland, U.S.A.), rab- bit anti-αSMA (1:1000, ab5694, Abcam, Cambridge, U.K.), rat anti-Klotho (1:1000, KO603, Transgenic Inc, Kobe,

Japan), and β-tubulin (1:25000, Sigma, U.S.A.). If necessary, membranes were subjected to mild stripping in 0.2 M

glycine, 0.1% SDS, pH 2.2 twice for 20 min and washed with TBS before blocking and reprobing.

RNA sequencing

Library preparation

The quality of the isolated RNA was determined with a Qubit® (1.0) Fluorometer (Life Technologies, California, U.S.A.) and a Bioanalyzer 2100 (Agilent, Waldbronn, Germany). Only those samples with a 260 nm/280 nm ratio between 1.8 and 2.1 and a 28S/18S ratio between 1.5 and 2 were further processed. The TruSeq RNA Sample Prep Kit v2 (Illumina, Inc, California, U.S.A.) was used in the succeeding steps. Briefly, total RNA samples (100–1000 ng) were poly-A-enriched and then reverse-transcribed into double-stranded cDNA. The cDNA samples were fragmented, end-repaired, and polyadenylated before ligation of TruSeq adapters. Adapters containing the index for multiplexing fragments were on both ends selectively enriched with PCR. The quality and quantity of the enriched libraries were validated using Qubit® (1.0) Fluorometer and the Caliper GX LabChip® GX (Caliper Life Sciences, Inc., U.S.A.). The product is a smear with an average fragment size of approximately 260 bp. The libraries were normalized to 10 nM in Tris-Cl 10 mM, pH 8.5 with 0.1% Tween 20.

Cluster generation and sequencing

The TruSeq PE Cluster Kit HS4000 or TruSeq SR Cluster Kit NovaSeq6000 (Illumina, Inc, California, U.S.A.) was used for cluster generation using 10 pM of pooled normalized libraries on the cBOT. Sequencing was performed on the Illumina NovaSeq 6000 single-end 100 bp using the TruSeq SBS Kit NovaSeq6000 (Illumina, Inc, California, U.S.A.).

Data analysis

Reads were quality-checked with FastQC. Sequencing adapters were removed with Trimmomatic [22] and reads were hard-trimmed by five bases at the 3′ end. Successively, reads at least 20 bases long, and with an overall average phred




quality score greater than 10 were aligned to the reference genome and transcriptome of Mus musculus (FASTA and GTF files, respectively, downloaded from GRCm38.p5, Release 91) with STAR v2.7.1 [23] with default settings for single end reads.

Distribution of the reads across genomic isoform expression was quantified using the R package GenomicRanges

from Bioconductor Version 3.10. Differentially expressed (DE) genes were identified using the R package edgeR


from Bioconductor Version 3.10.

A gene is marked as DE if it possesses the following characteristics:




at least ten counts in at least half of the samples in one group.


P≤0.05.

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022




log2(fold change) ≥ 0.5 or ≤ −0.5.




DE genes are then used as input for a Gene Ontology (GO)-based pathway analysis using the R package goseq [26] or GO Enrichment Analysis tool [27].




Real-time semi-quantitative RT-PCR

Total RNA from ∼30 mg of kidney tissue was extracted using the NucleoSpin RNA kit (Macherey-Nagel, Du¨ren, Germany) according to the manufacturer’s instructions. Reverse transcription was performed with the TaqMan Re- verse Transcription Kit (Applied Biosystems, Forster City, CA, U.S.A.). A total of 300 ng RNA was diluted in a 20-µl reaction mix that contained: RT buffer (1×), MgCl2 (5.5 mM), random hexamers (2.5 µM), RNAse inhibitor (0.4 U µl−1), the multiscribe reverse transcriptase enzyme (1.25 U µl−1), deoxyNTP mix (500 µM each), and RNA-free water. Semi-quantitative real-time PCR was performed on the QuantStudio 6 Pro (Applied Biosystems, Forster City,

CA, U.S.A.) using the PowerUp™ SYBR® Green Master Mix (Applied Biosystems, Vilnius, Lithuania) according to manufacturer’s instructions. The expression of the genes of interest was calculated in relation to hypoxanthine guanine phosphoribosyl transferase (HPRT). Relative mRNA levels were calculated as R = 2ˆ#x2212 (Ct, target gene −

Ct, internal control gene).

Primer sequences were: Cyp4a14, Forward (Fw): 5′ GACGTTTGTCCCACCATGCC 3′, reverse (Rv): 5′ TGGC- CTTCTGCAGCTCTTCC 3′; Nr4a3, Fw: 5′ AGCTGGGCAGAAAAGATCCC 3′, Rv: 5′ CCCAAATCCTCGAAG- GCACT 3′; Hspa1b, Fw: 5′ CACCATCGAGGAGGTGGATT 3′, Rv: 5′ CTTGACAGTAATCGGTGCCCA 3′; coag- ulation factor II (F2), Fw: 5′ATGGGGTGAAGGATGTGACC 3′, Rv: 5′GTAGGTCCTTTACCCACCCAC 3′; Ces1g, Fw: 5′ GGAGGCCCAGTCATGTTTGA 3′, Rv: 5′ TTGTGTCCCACTGGTGTCAG 3′; Col6a6, Fw: 5′ CCACTGC- CTCCACTGACATT 3′, Rv: 5′ TGAAATCCAGAGGCACAAATCT 3′.




Flow cytometry and renal cell isolation





Right kidneys were harvested from isoflurane anesthetized mice, cut into three pieces, and immediately placed in ice-cold PBS. Isolation of immune cells from kidney was performed using a modified version of the protocol published by Nistala et al. [28]. Digestion was achieved by placing kidney tissue in a gentleMACS C-tube with 3 ml RPMI medium containing 10% fetal calf serum (FCS), DNase I (200 µg/ml, VWR) and Collagenase I (2.4 mg/ml, Gibco), and dissociated using gentleMACS (Miltenyi) according to the manufacturer’s protocol (lung 1 and lung 2). Residual cell debris was removed using a 100-µm cell strainer and red blood cells were lysed with ACK buffer (155 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA, pH 7.4) for 3 min at RT.

Leukocytes were obtained by density gradient separation. Briefly, the pellet was resuspended in 0.25 M sucrose, mixed 1:1 with 72% Percoll (GE Healthcare) and overlaid on a 72% Percoll solution. Leukocytes were harvested from the white interphase and stained for flow cytometry. Single cell suspensions were stained extracellularly with fluorescently labeled antibodies in FACS buffer (2% FCS, 5 mM EDTA, 0.05% NaN3 in PBS) for 20 min at RT in the dark, fixed with BD Fixation/Permeabilization Solution (BD Biosciences) for 10 min at RT and acquired on a BD LSRFortessa (BD Biosciences). Data were analyzed using the FlowJo Software (TreeStar).

Fluorescently labeled antibodies against murine MHC-II-Pacific Blue (M5/114.15.2), CD3-FITC (17A2), CD4-APC (RM4-5), CD8a-PE (53-6.7), CD11b-Alexa Fluor 594 (M1/70), CD11c-PerCP (N418), F4/80-PE-Cy7

(BM8), Ly-6G-Brilliant Violet 785 (1A8), and Ly-6C-Brilliant Violet 711 (HK1.4), were purchased from BioLegend. LIVE/DEAD Fixable Near-IR Dead Cell Stain (Invitrogen) was used to exclude dead cells.




Statistical analysis

Data are shown as mean −+ standard deviation (SD). Comparisons of values from three or more groups were per- formed using one- or two-way ANOVA followed by Bonferroni’s post hoc test. Comparison between two groups was performed with a two-tailed unpaired Student’s t test. Results were considered statistically significant at P<0.05. Sta-

tistical analyses were performed using R [29] (Rstudio version 1.4.1103) or GraphPad Prism 8.2.1 (GraphPad Software

Inc.). Statistical analysis of RNA-sequencing data is described in the ‘RNA sequencing (Materials and methods sec- tion)’ subsection. Minimum sample size was defined a priori by power analysis (n=12 for untreated and therapeutic groups in a minimum of three independent experiments). Experiments performed with the goal of comparing NaCl with NaHCO3 intake in crystal nephropathy were performed with n=8 (see subsection on ‘Oxalate nephropathy and alkali therapy’ for further details on sample size of this experiment). Outliers were not excluded.




Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Results

Prophylactic and therapeutic alkali therapies protect kidney function in murine crystal nephropathy

Crystal nephropathy was induced by feeding mice oxalate, and alkali therapy was given as either prophylactic or therapeutic NaHCO3 supplements. One group received water without the addition of bicarbonate (untreated group) (Figure 1A). Crystal nephropathy impaired renal function as indicated by elevated plasma urea and creatinine and reduced urea and creatinine clearances (Figure 1B–E). Further changes in urinary parameters included hypermag- nesuria and hypercalciuria, but there was no alteration in sodium excretion (Figure 1F–H). Ammonium excretion on the fourth day of exposure to oxalate diet was reduced but returned to normal levels in the untreated group by the fourth day of recovery (Supplementary Figure S1A,B and Figure 1I).

Prophylactic alkali therapy prevented all these alterations, ammonium excretion was reduced below control lev- els, and sodium excretion was elevated in response to the higher sodium intake (Figure 1B–I). Most importantly, therapeutic treatment rescued kidney function in the nephropathy group while having no effects in healthy animals (Figure 1B–E). Likewise, alkali therapy normalized urinary calcium and magnesium excretion in all treated mice (Figure 1F,G) and sodium excretion increased (Figure 1H). In addition, both alkali therapy protocols effectively ele- vated urine pH, while untreated oxalate mice showed more acidic urine at both the beginning and end of the recovery phase (Supplementary Figure S1C–E). Therapeutic treatment caused a transient body weight loss, which was fully re- verted by the end of the treatment period (Supplementary Figure S1F).

In addition, we repeated these experiments replacing tap water with 0.2 M NaCl to distinguish whether positive effects provided by alkali therapy originated from a bicarbonate or sodium load. Oxalate nephropathy mice subjected to 0.2 M NaCl showed acidemia, hypernatremia, hyperchloremia, increased kidney weight, a trend towards protein- uria, and severely reduced urea and creatinine clearance (Supplementary Figure S2A–H). Alkali therapy prevented or attenuated those changes. In the NaCl-loaded group of animals two animals had to be killed before the end of the experiment (Supplementary Figure S2I). Therefore, alkali therapy provided its benefits not because, but despite the associated sodium load and all further experiments were performed only for animals treated with tap water or alkali therapy unless otherwise stated.

The kidney injury marker NGAL was elevated by crystal nephropathy in untreated mice (Figure 2A). On the fourth day of crystal nephropathy induction, NGAL values were approximately 19-times higher and remained so until the fourth day of recovery. On the 28th recovery day, NGAL was only four-times higher in comparison to the respective control group. NGAL elevation was greatly prevented by the prophylactic treatment, showing only a transient increase during the induction and at the beginning of the recovery phase before normalizing by the end of the treatment. NGAL excretion was very similar between therapeutically treated and untreated mice (Figure 2A).

Oxalate diet in untreated mice caused profound structural changes to kidneys. Kidney weight was reduced on an average by 23.3 −+ 4% (n=8/group, P<0.05) and histopathological assessment showed that crystal nephropathy in untreated mice caused acute renal tubular injury, tubular atrophy and fibrosis, and interstitial inflammation (Figure

2B–E). Fifty percent of these mice developed glomerulosclerosis (Figure 2F). Further quantification of fibrosis by van Gieson staining showed accumulation of collagen in renal tissue by crystal nephropathy (Supplementary Figure S3A,E,F). Therapeutic treatment caused minor differences in histopathology scores, with a trend towards reduction in tubular atrophy and fibrosis and with less mice suffering from interstitial inflammation (Figure 2B–F).

Crystal deposition initiates interstitial inflammation and fibrosis [30] and quantification by polarized light mi- croscopy suggested reduction in crystal deposition in animals with alkali therapy by the end of the recovery phase

(Supplementary Figure S3B,G). However, on the 28th recovery day, untreated mice showed largely reduced renal crystal content when compared with the 4th day of recovery (1.75 −+ 1.42% of renal parenchyma vs 0.37 +− 0.23%,



(A)











(A)









(B)





(B)




150




Plasma urea

*** ***

***







*

(C)



(C)





Plasma creatinine (mg/dl)



0.3




Plasma creatinine

(D)



(D)



*** ***

** *











8




Urea clearance




Plasma urea (mg/dl)



100




50




0




Control Oxalate

2-way ANOVA Interaction

p = 0.0002




Diet

p < 0.0001




Treatment p < 0.0001




0.2




0.1




0.0




Control Oxalate

2-way ANOVA Interaction

p = 0.0006




Diet

p < 0.0001




Treatment p = 0.0164




6




l/min/BW(g)



4




2




0

Control Oxalate




2-way ANOVA




*







Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Interaction p = 0.087




Diet

p = 0.035




Treatment p = 0.064






(E)



(E)



Creatinine clearance

(F)




Magnesium excretion

**

** *







*

(G)




Calcium excretion




*

*







40




2-way ANOVA

l/min/BW(g)



30

Interaction p = 0.1252

20

Diet

p = 0.0230

10

Treatment p = 0.0348

0



(F)





0.20




Mg2+ (mg/24h)



0.15




0.10




0.05




0.00

**

*




2-way ANOVA




Interaction p = 0.141




Diet

p = 0.007




Treatment p < 0.001



(G)





0.5




Ca2+ (mg/ 24h)



0.4




0.3




0.2




0.1




0.0

** ***




**







2-way ANOVA




Interaction p = 0.008




Diet

p = 0.033




Treatment p < 0.001

Control Oxalate

Control Oxalate

Control Oxalate



(H)





(H)




Sodium excretion

(I)




Ammonium excretion
(I)



*

*** ***









* ***

20




1.0

***

***




Na2+ (mmol / 24h)



15




10




5




0

Control Oxalate




2-way ANOVA




Interaction p < 0.001




Diet

p = 0.042




Treatment p < 0.001




0.8




NH4+ (mg/24h)



0.6




0.4




0.2




0.0




***

***







Control Oxalate




2-way ANOVA










Interaction p = 0.452




Diet

p = 0.165




Treatment p < 0.001




Figure 1. Prophylactic and therapeutic alkali therapies protect kidney function in crystal nephropathy

C57BL/6 mice subjected to 10 days calcium-free diet containing 0.67% oxalate (crystal nephropathy induction) or calcium-free diet (control induction) were fed afterwards with standard diet for 28 days (recovery period). Mice were treated with 0.2 M NaHCO3 in water during the whole induction and recovery periods (prophylactic therapy), only during the recovery period (therapeutic alkali therapy) or with tap water (untreated group). (B–I) Plasma and urine were collected on the 28th day of recovery and plasma urea


and creatinine (C), clearance of urea (D) and creatinine (E), and 24-h excretion of magnesium (F), calcium (G), sodium (H), and ammonium (I) were measured/calculated. Black circles = untreated group, red squares = therapeutic therapy, blue triangles = prophylactic therapy. Two-way ANOVA was calculated for alkali treatment and diet types, followed by a Bonferroni’s post-test,

*P<0.05, **P<0.01, ***P<0.001, n=7–8/group except for prophylactic alkali therapy groups that have n=4.






P=0.017, n=8, Supplementary Figure S4), demonstrating that most of the crystals were cleared over the period of 4 weeks independently of alkali therapy. Importantly, therapeutically treated animals showed higher levels of urea and creatinine clearance than untreated animals, when comparing those mice with similar degrees of IFTA (Figure 2G,H).

Similarly, when plotting crystal content against urea or creatinine clearance, those animals with similar crystal con- tent had better kidney function after treatment with alkali therapy (Supplementary Figure S3C,D). Collectively, these




(A)



(B)







(A) (B)

Urinary NGAL in 24h




4th day 4th day 28th day 4th day 4th day 28th day

Induction recovery recovery Induction recovery recovery

***

***

***

***




###

###

Control

Oxalate







Relative weight (%)



5000




4000




(C)





0.016




0.014




0.012




0.010




0.008




***

**

*** **







Relative kidney weight







Acute tubular injury










4




Score (0-3)



3




2




1




(E)



NGAL (ng/24h)



3000




(D)











0.006




Control Oxalate




Interstitial fibrosis and tubular atrophy (IFTA)










0

Control Oxalate






Interstitial Inflammation

2000




1000




0

40










Area affected (%)



30




20




10




0

Control Oxalate

1.5




Presence (0) or Absence (1)



1.0




0.5




0.0










Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Control Oxalate













Untreated Therapeutic Prophylactic




(F)











2.5




Score (0-3)



2.0




1.5




1.0




0.5




Glomerulosclerosis




(G)





40




IFTA (%)



30




20




10

IFTA x Urea clearance (only oxalate nephropathy)




(H)







40




IFTA (%)



30




20




10

IFTA x creatinine clearance (only oxalate nephropathy)




0.0




Control Oxalate




0

0 50 100 150 200

Urea clearance (l/min)




0



0 200 400 600 800 1000

Creatinine clearance (l/min)




Figure 2. Alkali therapy plays a minor role in protecting renal injury and morphological changes in the kidneys

(A) Twenty-four hour NGAL excretion on the 4th day of nephropathy induction, and 4th and 28th day of recovery. (B) Kidney weight relative to body weight. (C–F) Morphological assessment of kidney tissue for acute tubular injury (C), IFTA (D), interstitial inflam- mation (E), glomerulosclerosis (F). IFTA plotted against urea (G) and creatinine clearance (H). Black circles = untreated group, red squares = therapeutic therapy, blue triangles = prophylactic therapy. Two-way ANOVA was calculated for alkali treatment and diet types, followed by a Bonferroni’s post-test, **P<0.01, ***P<0.001 vs. respective control groups, ###P<0.001 vs. respective untreated groups, n=7–8/group except for prophylactic alkali therapy groups that have n=4.









data demonstrate that alkali therapy rescues kidney function by mechanisms beyond reduction in crystal deposition, fibrosis, and tubulointerstitial damage.

Since prophylactically treated animals showed almost full protection against oxalate nephropathy, likely due to higher solubility of oxalate crystals in an alkaline environment, we focused our further investigations on untreated and therapeutically treated animals to identify pathways modulated by alkali.

Despite similar histological renal fibrosis levels between both nephropathy groups, molecular markers of fibro- sis showed clear differences between groups. Crystal nephropathy increased protein abundance of Vimentin, which was attenuated by therapeutic treatment (Figure 3A). On the other hand, αSMA abundance was elevated in thera- peutically treated mice, with no change in untreated animals (Figure 3B). Transcriptome analysis of whole kidneys showed similar patterns for both markers, with reduction in Vim mRNA, but no change in aSMA (Acta2) mRNA levels (Figure 3C,D). To further dissect the role of alkali therapy in fibrosis, we used specific markers of different populations of fibroblasts and myofibroblasts recently identified by Kuppe et al. [31]. The markers were (following the nomenclature by Kuppe et al. for each subpopulation): Scara5 (fibroblast1), Ogn and Col14a1 (myofibroblast 2), Nkd2 (myofibroblast 1a), Grem2 (myofibroblast 1b), Frzb (myofibroblast 3b) (Figure 4A–F). Crystal nephropa- thy elevated markers of myofibroblast 2, 1a, and 1b, with a minor reducing effect on 3b, and no effect on fibroblast

1. Alkali therapy elevated Scara5 and caused a trend towards reduction in Nkd2 in nephropathy mice. In order to understand how these markers could be associated with Vim and Acta2, we plotted them against the expression of (myo)fibroblast markers (Figure 4G–L). Acta2 mRNA levels linearly correlated with myofibroblast 2 markers (Ogn, untreated R2 = 0.82 and therapeutic R2 = 0.94; Col14a1, untreated R2 = 0.81 and therapeutic R2 = 0.81), while Vim correlated with the myofibroblast 1a marker Nkd2 (untreated, R2 = 0.98, therapeutic, R2 = 0.94). Other fibro- sis markers, such as Fibronectin 1 (Fn1, untreated R2 = 0.99, therapeutic R2 = 0.96) and Col1a1 (untreated R2 =




(A)

VIM

(B)

α-SMA











(A)


(B)









Vimentin (Vim)

 -SMA (Acta2)




***

**







*







6 4

Normalised Vimentin/ -tubulin



Normalized

 -SMA/ -tubulin



2-way ANOVA 3

4

Interaction

p = 0.003 2

2 Diet

p < 0.001 1

Treatment p = 0.020

Control



Oxalate



Control



Oxalate



Control



Oxalate



Control



Oxalate



0 0




2-way ANOVA Interaction

p = 0.223




Diet

p = 0.002




Treatment p = 0.017



(C)


(D)







(C) (D)

Vim mRNA




Acta2 mRNA

*** ***

***



Normalized counts



15000




10000

5000




***

**













Normalized counts



4000




3000







5000

2000




1000




Control



Oxalate



Control



Oxalate



Control



Oxalate



Control



Oxalate



0 0




Figure 3. Alkali therapy effects on fibrosis markers

(A) Vimentin protein. (B) αSMA protein. Western blotting was performed with 30 µg of kidney total homogenate per lane in an SDS/PAGE gel. (C) Vim mRNA. (D) Acta2 mRNA. mRNA levels were determined by RNA sequencing (RNAseq) using whole kidney RNA. Black circles = untreated group, red squares = therapeutic therapy. For protein data, two-way ANOVA was calculated for alkali treatment and diet types, followed by a Bonferroni’s post-test, *P<0.05, **P<0.01, ***P<0.001. n=7–8/group. RNAseq DE genes: fold change ≥ 0.5, **P<0.01, ***P<0.001, n=5/group.









Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



0.99, therapeutic R2 = 0.97) also correlated with Vim. On the other hand, Vim poorly associated with Ogn (Fn1, untreated R2 = 0.81, therapeutic R2 = 0.70), while both Acta2 and Vim did not correlate with Scara5 levels. These strong positive correlations indicate that these subpopulations may contribute to the production of extracellular ma- trix in crystallopathy. Alkali therapy also down-regulated Ctgf (Supplementary Figure S5A). However, no changes were observed for other markers, such as Col1a1, Col3a1, Fn1, TgA 1, Vegfa, and Mmp2 (Supplementary Figure

S5B–G). Among collagen genes, Col6a6 mRNA reduction by crystal nephropathy was recovered by alkali therapy

(Supplementary Figure S5H). In summary, alkali therapy neither reduced the accumulation of collagen, nor the ex- pression of markers of the subpopulations of myofibroblasts responsible for the production of collagen, nor most fibrosis markers. However, alkali therapy appeared to interact with Scara5 and Nkd2 positive subpopulations and with the production of Vimentin. Lowering Nkd2 has been shown to reduce fibrosis [31].



(A)


(B)


(C)





















Untreated Therapeutic







Normalized counts



200




150




100




50

Scara5 (fibroblast 1)




*







Normalized counts



1500




1000




500

Ogn (myofibroblast 2)




**

**







2500




Normalized counts



2000




1500




1000




500

Col14a1 (myofibroblast 2)




0
(D)



Control Oxalate




0
(E)



Control Oxalate




0
(F)



***

***







Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Control Oxalate

















Normalized counts



400




300




200




100




0

Nkd2 (myofibroblast 1a)




***

***







Control Oxalate




500




Normalized counts



400




300




200




100




0

Grem2 (myofibroblast 1b)




*







Control Oxalate




1500




Normalized counts



1000




500




0

Frzb (myofibroblast 3b)










Control Oxalate











(G)


(H)


(I)













Ogn x Acta2

Nkd2 x Vim

Nkd2 x Fn1



5000

15000

15000




4000




Acta2



3000




Vim



10000




Fn1



10000




2000




1000




5000




5000




0

0 500 1000 1500

Ogn




0

0 100 200 300 400







Nkd2




0

0 100 200 300 400







Nkd2



(J)

















Ogn x Vim

Acta2 x Scara5

Vim x Scara5
(K)


(L)





15000

200

15000







10000

150




10000




Vim



Scara5



Vim



100




5000




5000

50




0

0 500 1000 1500

Ogn

0

0 1000 2000 3000 4000 5000

Acta2

0

0 50 100 150 200

Scara5




Figure 4. Alkali therapy differentially regulates markers of various subpopulations of myofibroblasts and fibroblasts

RNA sequencing signal of (A) Scara5 (fibroblast 1), (B) Ogn (myofibroblast 2), (C) Col14a1 (myofibroblast 2), (D) Nkd2 (myofibroblast 1a), (e) Grem2 (myofibroblast 1b), and (F) Frzb (myofibroblast 3b). Acta2 mRNA levels were positively associated with Ogn (G), Vim (H), and Col1a1 (I) were positively associated with Nkd2, while Vim (J) was poorly associated with Ogn. Neither Acta2 (K) nor Vim

(L) were associated with Scara5. Black circles = untreated group, red squares = therapeutic alkali therapy. RNAseq DE genes: fold

change ≥ 0.5, **P<0.01, ***P<0.001, n=5/group.






Crystal nephropathy affects the aldosterone–endothelin axis and ammoniagenic enzymes independent of alkali therapy

Augmented levels of circulating hormones, such as aldosterone and endothelin have been proposed to playa central role in the pH-dependent effects contributing to the progression of CKD [32,33] but appear not to play a major role in our model. Urinary aldosterone on the 4th and 28th day of recovery was not elevated in crystal nephropathy (Figure 5A,B). No differences were observed between alkali-treated and untreated groups on the fourth recovery day. On the 28th day of recovery, alkali therapy reduced urinary aldosterone levels in control animals, but no difference was observed between crystal nephropathy groups (Figure 5B). Similarly, plasma aldosterone levels were mildly reduced by alkali therapy, but unchanged by nephropathy induction (Figure 5C). Mineralocorticoid receptor Nr3c2 mRNA expression was unaltered in all groups (Figure 5D).

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Crystal nephropathy did not alter urinary endothelin-1 levels while alkali therapy unexpectedly stimulated endothelin-1 levels (Figure 5E,F). Crystal nephropathy increased renal mRNA expression of Endothelin-1 (Edn1) and endothelin receptors Ednra (Figure 5G,H) and Ednrb. Alkali therapy attenuated Edn1 elevation without major effects on the receptors.

Experiments in partially nephrectomized rats demonstrated that renal tissue accumulation of ammonium can ac- tivate the renal alternative complement pathway, which is counteracted by administration of bicarbonate [13]. On the other side, reduced urinary ammonium excretion is a predictor of CKD progression [34]. Crystal nephropathy down-regulated the transcripts of Glud1 (Glutamate Dehydrogenase) and Ogdh (Oxoglutarate Dehydrogenase), en- zymes involved in ammoniagenesis and generation of de novo bicarbonate (GEO accession GSE179216). However, Pck1 (PEPCK) and Gls (Glutaminase) were unaltered in nephropathy animals. Alkali therapy down-regulated Pck1 mRNA both in control as in crystal nephropathy. Alternative complement pathway genes, C3 and Hc (C5) were ele- vated by crystal nephropathy and alkali therapy attenuated these alterations (GEO accession GSE179216).




Alkali therapy protects anti-aging protein klotho

α-klotho exerts renoprotective effects and is down-regulated early in the development of kidney disease [35,36]. Bicarbonate supplementation attenuated the fall in soluble klotho levels in a CKD model [37]. In our model, the reduction in renal Klotho mRNA (Kl) and protein levels by crystal nephropathy was almost fully reversed by alkali therapy (Figure 6A–C). In human umbilical vein endothelial cells (HUVECs), rat aorta, and brain, α-klotho reduces the expression of endothelial cell adhesion molecules, such as ICAM1 and VCAM1, leading to reduced inflammatory monocyte adhesion [38,39]. Here, both Icam1 and Vcam1 elevation by crystal nephropathy were strongly attenuated by therapeutic alkali therapy (Figure 6D,E).




Alkali therapy improves inflammatory and metabolic pathways

We performed pathway analysis using whole transcriptome data from whole kidney tissue in control and crystal nephropathy conditions, with or without therapeutic alkali therapy (normalized counts for all genes in GEO ac- cession GSE179216). Crystal nephropathy altered the expression of 4923 transcripts causing significant changes in multiple biological processes, molecular functions, and cellular components (Supplementary Spreadsheet 1 and Ap- pendix 1). Crystal nephropathy down-regulated transcripts associated with multiple metabolic processes (e.g. NAD

biosynthetic process, fatty acid β-oxidation using acyl-CoA dehydrogenase, lipid metabolic process), transporter and enzymatic activities, mitochondrial structure, and others (Supplementary Appendix 1A–C). Moreover, crystal

nephropathy up-regulated transcripts involved in cell adhesion, inflammation, and various processes and cell com- ponents involved in tissue remodeling, such as the binding of extracellular matrix, integrin, heparin, actin, and others (Supplementary Spreadsheet 1 and Appendix 1D–G). Altogether, pathway analysis reflected large alterations caused by processes of tissue damage and repair. Alkali therapy per se in control kidneys affected 125 transcripts belong- ing to GO categories related to metabolic processes (e.g. lipid, glutathione, and cholesterol metabolic processes), and influenced the expression of transporters, and genes that control blood microparticles content (Supplementary Spreadsheet 1 and Appendix 1S–U).

Alkali therapy in nephropathy kidneys modified the expression levels of 1103 genes and reversed or attenuated the dysregulation of 795 transcripts demonstrating the ability to correct by large the pathologic dysregulation im- posed by crystal nephropathy (Supplementary Spreadsheets 1 and 2, Figure 7A, Supplementary Figure S6). Among the genes up-regulated by nephropathy, 616 were fully or partially reversed and enriched in distinct pathways in- cluding positive regulation of monocyte aggregation, positive regulation of leukocyte cell–cell adhesion, positive reg- ulation of T-cell activation, and multiple other immune-related processes such as cell adhesion, chemotaxis, and






(A)













Urinary aldosterone 4th day of recovery

Untreated Therapeutic




Urinary aldosterone 28th day of recovery



(B)



***

*







**

**













3000 4000







Aldosterone (pg / 24h)



2000




1000




0

Control Oxalate
(C)









Aldosterone in plasma

2-way ANOVA

Interaction p = 0.191

Diet

p < 0.001

Treatment p = 0.086




3000




Aldosterone (pg / 24h)



2000




1000




0

Control Oxalate
(D)









Nr3c2 mRNA

2-way ANOVA

Interaction p = 0.004

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Diet

p = 0.101

Treatment p < 0.001

Aldosterone (pg/ml)



1500




1000




500




0










Control Oxalate




2-way ANOVA Interaction

p = 0.998

Diet

p = 0.911

Treatment p = 0.002

800




Normalized counts



700




600




500




400










Control Oxalate












(E)



Endothelin-1 (pg/ 24h)



1.0




0.8




0.6




0.4




0.2




0.0

Urinary endothelin-1 4th day of recovery




*** ***







Contro Oxalate




2-way ANOVA

Interaction p = 0.111

Diet

p = 0.005

Treatment p < 0.001






(F)



Endothelin-1 (pg/ 24h)



1.5




1.0




0.5




0.0

Urinary endothelin-1 28th day of recovery




***

**







Control Oxalate




2-way ANOVA

Interaction p = 0.942

Diet

p = 0.678

Treatment p < 0.001



(G)









Edn1 mRNA

Ednra mRNA










500




Normalized counts



400




300




200




100

***



(H)



*** *











Normalized counts



400




300




200




100

***




0

Control Oxalate

0

***







Control Oxalate




Figure 5. Aldosterone and endothelin-1 are not elevated in crystal nephropathy but respond to alkali therapy

Urinary aldosterone on the (A) 4th and (B) 28th day of recovery. (C) Plasma aldosterone on the 28th day of recovery. (D) Nr3c2 mRNA (mineralocorticoid receptor). Urinary endotelhein-1 on the (E) 4th and (F) 28th day of recovery. (G) Edn1 mRNA. (H) Ednra, endothelin receptor type A, mRNA. Black circles = untreated group, red squares = therapeutic therapy. ELISA data were analyzed by two-way ANOVA for alkali treatment and diet types, followed by a Bonferroni’s post-test, *P<0.05, **P<0.01. n=7–8/group for ELISA data and n=5/group for RNAseq data. RNAseq DE genes: fold change ≥ 0.5, **P<0.01, ***P<0.001, n=5/group.









Klotho














(A)


(B)











Klotho WB



Untreated Therapeutic





(C)









Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Kl mRNA




**

*







** **



Relative densitometric value



2.0 40000




1.5




1.0




0.5




Control



Oxalate



Control



Oxalate



0.0

2-way ANOVA




Interaction p = 0.223




Diet

p < 0.001




Control



Oxalate



Control



Oxalate



Treatment p = 0.001

30000




Normalized counts



20000




10000




0







8000

Vcam1 mRNA



(D)


(E)



***

*** ***



















3000

Icam1 mRNA

***




***

***







Normalized counts



Normalized counts



6000

2000

4000

1000

2000




0

Control Oxalate

0

Control Oxalate




Figure 6. Alkali therapy prevents reduction in renal α-klotho levels

(A) Klotho protein detected by western blotting. (B) Densitometry of Klotho immunoblotting. (C) Klotho (Kl), (D) Vcam1, and (E) Icam1 mRNA levels. Black circles = untreated group, red squares = therapeutic therapy. Western blotting data were analyzed by two-way ANOVA for alkali treatment and diet types, followed by a Bonferroni’s post-test, *P<0.05, **P<0.01. n=7–8/group for

western blotting data and n=5/group for RNAseq. RNAseq DE genes: fold change ≥ 0.5, **P<0.01, ***P<0.001, n=5/group.













Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Figure 7. RNA sequencing data showing GO categories enriched in the subpopulations of genes altered by oxalate nephropathy and restored by alkali therapy

Up-regulated biological processes (A) by alkali therapy. Color of the circles represent false discovery rate according to the scale on the right side of each graph. Size of the circle represents the number of genes down-regulated in a given GO category. (B) Volcano plot showing genes that were considered up- or down-regulated by alkali therapy in crystallopathy groups. Named genes represent top ten up- and down-regulated genes recovered by alkali therapy. Red dots represent significantly altered genes by alkali therapy.

Black dots represent unaltered genes. Gray dots represent genes that were not detected by RNAseq in comparison to the mouse transcriptome. n=5/group.






cell proliferation (Supplementary Figure S6A–C and Spreadsheets 2 and 3). Likewise, alkali therapy restored the ex- pression of 179 transcripts that had been down-regulated by crystal nephropathy. These transcripts were commonly related to cell metabolism grouped in pathways involved in transmembrane transport, fatty acid metabolic process, triglyceride lipase activity, heme binding, carboxylic acid transmembrane transporter activity, serine hydrolase ac- tivity, and oxidoreductase activity (Figure 7A, Supplementary Figure S6D and Spreadsheets 2 and 3). The top ten up- and down-regulated transcripts recovered by alkali therapy are listed in Table 1 and are shown on a volcano plot in Figure 7B. Top three up- and down-regulated genes by alkali therapy (Table 1) were also assessed by quantitative RT-PCR (qPCR) for sodium chloride-loaded groups and the respective alkali therapy groups (Supplementary Fig- ure S7). We failed to detect signal for F2, but up-regulation of Ces1g and Col6a6 and down-regulation of Cyp4a14 were similar to those observed between alkali therapy and untreated mice. Hspa1b was also down-regulated in re- lation to control-NaCl group, but down-regulation was also seen in oxalate-NaCl group. Despite a trend towards down-regulation by alkali therapy in control group, no major differences were observed across groups for Nr4a3.




Alkali therapy lowered frequency of CD4+ T helper cells and inflammatory monocytes caused by crystal nephropathy

Transcripts of various pro-inflammatory chemokines were among the most down-regulated genes in response to al- kali therapy suggesting that alkali therapy halts infiltration (or local expansion) of some immune cell types. We directly isolated renal immune cells and quantified Ly6G−Ly6G+ inflammatory monocytes, MHCII+F4/80+ macrophages, MHCII+CD11c+ dendritic cells, CD11b+Ly6G+ neutrophils, CD3+CD4+ T helper cells, and CD3+CD8+ cytotoxic T

cells by FACS (Supplementary Figure S8). The proportion of T cells, dendritic cells, and inflammatory monocytes raised in untreated crystal nephropathy kidneys, while alkali therapy mostly prevented the increase in inflammatory monocytes and CD3+ T cells (Figure 8A–F). Among T cells, the proportion of CD4+ T cells increased substantially because of crystal nephropathy, while that of CD8+ T cells remained mostly unchanged (Figure 8B). Alkali ther- apy strongly dampened these changes. Macrophages were not significantly affected by crystal nephropathy and neu- trophils were scarce in renal tissue across all groups. In agreement, alkali therapy reduced the expression of Ccl2 and Ccl5 mRNA, which are the main regulators of the abundance of inflammatory monocytes and CD4+ T helper cells, respectively (Figure 8G,H). In an acute phase of inflammation (4th day of recovery), the fraction of neutrophils and




Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Table 1 Top ten up- and down-regulated transcripts recovered by alkali therapy in crystal nephropathy kidneys





Gene ID

Gene name

P-value

FDR

Fold change


Recovered by alkali therapy from crystal nephropathy (down-regulated)


ENSMUSG00000028715

Cyp4a14

7.408e-06

0.012

−4.59


ENSMUSG00000028341

Nr4a3

0.000485

0.075

−3.55


ENSMUSG00000090877

Hspa1b

6.244e-05

0.034

−2.96


ENSMUSG00000037868

Egr2

0.0008796

0.096

−2.93


ENSMUSG00000026628

Atf3

9.886e-05

0.039

−2.93


ENSMUSG00000029380

Cxcl1

0.000175

0.048

−2.88


ENSMUSG00000038418

Egr1

0.004489

0.166

−2.68


ENSMUSG00000033730

Egr3

0.001675

0.118

−2.51


ENSMUSG00000049723

Mmp12

0.004486

0.166

−2.43


ENSMUSG00000029816

Gpnmb

0.006717

0.184

−2.36


Recovered by alkali therapy from crystal nephropathy (up-regulated)


ENSMUSG00000027249

F2

2.708e-07

0.004

2.59


ENSMUSG00000057074

Ces1g

1.976e-06

0.006

2.40


ENSMUSG00000043719

Col6a6

0.0002637

0.055

1.74


ENSMUSG00000074575

Kcng1

0.0009703

0.098

1.60


ENSMUSG00000024411

Aqp4

0.0004293

0.069

1.42


ENSMUSG00000042425

Frmpd3

0.000709

0.0887

1.34


ENSMUSG00000031283

Chrdl1

0.0007093

0.089

1.34


ENSMUSG00000019787

Trdn

0.00502

0.170

1.29


ENSMUSG00000005716

Pvalb

0.004979

0.170

1.25


ENSMUSG00000056752

Dnah9

0.004117

0.160

1.24


Abbreviations: FDR, false discovery rate; fold change, log2 (fold change).









Table 2 List of pathways restored by alkali therapy in crystallopathy mice and impacted by acid–base status in humans





Common acid–base-sensitive pathways in mouse and human




GO restored in mouse by alkali therapy




Regulated genes in human


Catalytic activity

GO:0003824 (MF)

ACADM, ACADSB, ACOT13, ALAD, ALDH3A2, BDH2, BHMT2, CAT, CCND1, ENTPD5, GALM, MSH3, NNMT, PGPEP1, PNPO, RAB29, RABL3, RASD1, SAT2, SHMT1, SUCLG1


Carboxylic acid transmemembrane transport

GO:0046943 (MF)

SLC26A6, SFXN2


Oxidoreductase activity

GO:0016491 (MF)

ACADM, ACADSB, ALDH3A2, BDH2, CAT, MT-ND3, MT-ND4l, PNPO, SELENOP


Transmembrane transport

GO:0022857 (MF)

KCNJ15, SLC4A4, SCN9A, SLC26A6, SLC4A9


Mitochondrion

GO:0005739 (CC)

ACADM, ACADSB, ACOT13, ALDH3A2, MT-ND3, MT-ND4l, RAB29, SFXN2, SHMT1, SUCLG1


Fatty acid metabolic processes

GO:0006631 (BP)

ACADM, ACASB, BDH2, ALDH3A2


Regulation of fatty acid transport

GO:2000191 (BP)

PLIN2


Regulation of hydrolase activity and DNA repair

GO:0051336, GO:0006281 (BP)

MSH3


Regulation of cell cycle

GO:0051726 (BP)

CCND1, DDIT3


Abbreviations: BP, biological process; CC, cellular component; MF, molecular function.









CD8+ T cells was increased by crystal nephropathy, but that of inflammatory monocytes was not significantly altered (Supplementary Figure S9).




Alkali therapy affects similar pathways in murine crystal nephropathy and human transplant kidneys

We next examined if the transcriptional changes observed in our murine crystal nephropathy model could also be found in human kidneys. We compared the murine data with gene expression data from human kidney transplant

patients in three different conditions [19]. The first group had no acidosis (n=9), the second had metabolic acidosis defined as serum bicarbonate below 22 mmol/l (n=9), and the last had acidosis and received sodium bicarbonate




(A)





(A)

15




CD3+ T cells

(B)




% cells



10




5




0




(C)



(C)

8




% cells



6




4




Control Oxalate




MHCII+CD11c+ Dendritic cells

*

2-way ANOVA Interaction

**

*







p = 0.043




Diet

p = 0.002
















Treatment p = 0.084




2-way ANOVA Interaction

p = 0.354




(B)



T cells

✱✱✱ ✱✱









8




6




% cells



4




2




0






CD8+

CD4+



2-way ANOVA Interaction

p = 0.029




Diet

p < 0.001




Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Treatment p = 0.004




2




0

(E)



(F)



Control Oxalate

Diet

p = 0.004

Treatment p = 0.102

Therapeutic

- + - +



Control Oxalate

(D)





















(D) + +

(E)

MHCII+F4/80+ Macrophages

(F)

CD3-Ly6G-Ly6C+ Inflammatory monocytes




1.0




% cells



0.5




0.0




(G)





(G)

1500

CD11b Ly6G Neutrophils




Control Oxalate




Ccl2 mRNA

*** ***









***




2-way ANOVA Interaction

p = 0.464

Diet

p = 0.126

Treatment p = 0.160




(H)





(H)

5




4




% cells



3




2




1




0




***

*** **



250




Control Oxalate




Ccl5 mRNA




2-way ANOVA Interaction









p = 0.504




Diet

p = 0.012




Treatment p = 0.102

0.4




% cells



0.3




0.2




0.1




0.0




Control Oxalate












2-way ANOVA Interaction

***

**







p = 0.009




Diet

p < 0.001




Treatment p = 0.017




mRNA signal



1000




500

200




mRNA signal



150




100




50




Untreated Therapeutic








0

Control Oxalate




0

Control Oxalate

Figure 8. Alkali therapy affects immune cell abundance (% cells) in kidney tissue

FACS was performed with leukocytes isolated from whole mouse kidney. (A) CD3+ T cells. (B) Left: representative FACS plots showing CD4 and CD8 expression among T cells. Right: quantification of CD4+ (blue) and CD8+ T cells (purple). (C) MHC-II+CD11c+ dendritic cells, (D) CD11b+Ly6G+ neutrophils. (E) MHC-II+F4/80+ macrophages, (F) CD3−Ly6G−Ly6C+ inflammatory monocytes.

(G) Ccl2 mRNA signal detected by RNAseq. (H) Ccl5 mRNA signal detected by RNAseq. Black circles = untreated group, red

squares = therapeutic therapy. FACS data were analyzed by two-way ANOVA for alkali treatment and diet types, followed by a Bonferroni’s post-test, *P<0.05, **P<0.01. * in purple refers only to CD4+ data. n=4–6/group for FACS. RNAseq DE genes: fold change ≥ 0.5, **P<0.01, ***P<0.001, n=5/group.






supplementation to normalize blood bicarbonate levels (n=4) [19]. All groups of patients had similar kidney function based on eGFR (without acidosis 48.0 −+ 11.6 ml/min/1.73 m2, with acidosis, 31.9 −+ 17.7, and acidosis and alkali therapy: 38.5 −+ 11.4, P=0.085). We had identified 40 genes that were altered in acidotic patients when compared with non-acidotic patients. The expression of three of these genes, ACADSB, KCNJ15, and SMHT1I, was restored

by alkali therapy. Thirty genes also showed increased expression upon alkali therapy, albeit not statistically significant

[19].

Here, we compared the gene lists and found that among genes regulated in human kidney biopsies, nine showed the same pattern in mice, four of which (Ddit3, Prlr, Rasd1, and Selenop) were statistically significant and the other five (Plin2, Sfxn2, Msh3, Galm, Aqp7) had significant P-values (P<0.05), but not significant fold change (log2(fold change) < 0.5). For six of these nine genes (Selenop, Rasd1, Sfxn2, Msh3, Galm, and Aqp7) the expression was altered in the same direction (either down- or up-regulation) in humans and mice (Supplementary Figure S10A–F,

[19]). The expression of several transcripts of the mitochondrial complex I subunits, such as MT-ND3 and MT-ND4L (human) and Mt-nd1 and Mt-nd2 (mouse), was also partially restored by alkali therapy (Supplementary Spreadsheet 1). These 40 genes altered between patients with and without acidosis belong to pathways whose activity was regulated




by alkali therapy in mice, such as transmembrane transport, fatty acid metabolic process, and oxidoreductase activity (Table 2, Supplementary Spreadsheet 2).




Discussion

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



An increasing number of clinical studies demonstrate the beneficial effects of alkali therapy on CKD. While most tri- als have shown that alkali therapy slows the progression of kidney function deterioration and enhances dialysis-free survival [4,40–42]. There are still significant gaps in the understanding of how acidosis causes its detrimental ef- fects and how alkali therapy may be beneficial. Here, we induced crystal nephropathy in C57BL/6 mice and analyzed functional, morphological, immunological, and molecular adaptations in response to oral intake of bicarbonate, a standard form of alkali therapy. The crystal nephropathy model replicates important features of human CKD such as anemia, metabolic acidosis, hyperphosphatemia, hyperparathyroidism, hyperkalemia, hypertension, and cardiovas- cular disease [43]. Also, events downstream of the damage caused by crystals, such as epithelial disruption, release of damage-associated molecular patterns (DAMPs), tissue inflammation, and fibrosis are common events in multi- ple forms of CKD [44,45]. Nevertheless, the oxalate nephropathy model cannot replicate all features of other CKD etiologies. Prophylactic alkali therapy almost fully protected animals against crystal damage probably because alkali increases solubility of calcium oxalate crystals and prevents crystal deposition and kidney damage. This protective effect of alkalinizing therapy is well known from cystinuria where an alkaline pH increases cystine solubility and reduces crystal formation and kidney disease. Likewise, in primary hyperoxalurias, addition of potassium citrate to other preventive therapies can reduce disease burden [46,47]. In contrast, therapeutic alkali therapy prevented organ dysfunction as evidenced by the correction of hypermagnesuria and hypercalciuria caused by crystal nephropathy, besides largely correcting the levels of markers of kidney function like plasma urea and creatinine clearance. Addi- tionally, and as expected, alkali therapy reduced ammonium excretion and counteracted the urinary acidification seen in untreated animals with crystal nephropathy.

Two distinct mechanisms may explain how alkali therapy could hinder the progression of CKD: prevent- ing the activation of the alternative complement pathway by ammonium [48]; reducing the stimulation of the angiotensin–aldosterone–endothelin axis by local acidification [14,32]. Evidence for both hypotheses comes from nephrectomized rats.

Reduction in ammonium excretion is a hallmark of CKD and is associated with worse outcome [34], while ammo- nium accumulation in the tissue has been proposed as a mechanism that drives renal tissue inflammation [48]. We observed a transient reduction in ammonium excretion by crystal nephropathy, but levels returned to normal or were even slightly higher during recovery. The expression of transcripts of ammoniagenic enzymes either remained unal- tered (Gls and Pck1) by crystal nephropathy or decreased (Glud1 and Ogdh). Alkali therapy strongly down-regulated

Pck1 expression levels when compared with all other groups and Glud1 and Ogdh in relation to control groups. Still, as many other genes involved in inflammatory processes, expression levels of C3 and Hc (C5), genes involved in the

alternative complement pathway, were partially recovered by alkali therapy. Therefore, crystal nephropathy simulates the typical impairment in ammoniagenesis present in CKD, and the increase in ammonium excretion in later phases may reflect functional recovery of kidney function.

The increase in aldosterone, endothelin, and angiotensin-II levels by local acid retention has been implicated in the alkali therapy-sensitive progression of CKD in rat nephrectomy models [3,14]. However, in our crystal nephropathy model, we did not find any evidence for a role of these hormones: neither plasma, nor urinary aldosterone, nor urinary endothelin levels were elevated in crystal nephropathy. The expression levels of both Ren and Agtr1 mRNA were reduced in crystal nephropathy and, if anything, were restored by alkali therapy. This is in agreement with a recent study which failed to detect effects of alkali therapy in patients with CKD on markers of the systemic or intrarenal renin–angiotensin–aldosterone system [49].

Since traditional explanations for the beneficial effects of alkali therapy appear not to be relevant for the crystal nephropathy model, we explored novel pathways. RNA sequencing and pathway analysis demonstrated that multiple hitherto not considered biological processes and molecular functions involved in immunological responses were af- fected in crystal nephropathy and were attenuated or fully reversed by alkali therapy. Among these pathways, the GO category ‘chemokine activity’ was one of the most effectively protected molecular functions by alkali therapy. Stimula- tion of immune cells and release of cytokines are sensitive to pH and bicarbonate [12,50]. However, the role of pH and bicarbonate-sensitive immune regulation in the setting of kidney disease has not been shown to date. In our crystal nephropathy model, alkali therapy prevented the spiking of chemokines and cell adhesion molecules, such as Cxcl1, Ccl2, Ccl5, Lif , Il1a, Vcam1, and Icam1. Therefore, we tested whether alkali therapy modulates renal immune cell recruitment. Alkali therapy reduced the abundance of inflammatory monocytes and CD4+ T helper cells, along with




the reduction in the expression levels of their main regulators Ccl2 and Ccl5, and restored a pool of genes related to T-cell differentiation and monocyte aggregation. Leukocyte recruitment also requires endothelial cell adhesion molecules, such as ICAM1 and VCAM1, both down-regulated at mRNA level by alkali therapy. In human umbilical endothelial cells, acidosis stimulates cell adhesion via proton-activated G protein-coupled receptor 4 (Gpr4) [51,52]. Deficient models for two proton-activated GPCRs, GPR4 (Gpr4) and OGR1 (Gpr68) showed reduced expression of cell adhesion genes in murine inflammatory bowel disease models [53,54]. Crystal nephropathy increased the ex- pression of both GPCRs, but alkali therapy reduced only the expression of Gpr68. Conversely, in vitro experiments

have shown that α-klotho suppresses the cell adhesion molecules ICAM1 and VCAM1 in a TNF-dependent man- ner [39]. In our experiments, despite severe tissue damage, renal α-klotho was maintained at normal levels by alkali therapy in crystal nephropathy. Klotho-deficient mice (kl/kl) display shorter lifespan and suffer from severe vascular

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



calcification [55]. Both conditions were attenuated by bicarbonate supplementation along with a reduction in plasma aldosterone levels in kl/kl mice [37]. Likewise, in patients with CKD, bicarbonate supplementation restored urinary levels of soluble klotho supporting the translational relevance of the observations in murine models [17].

However, the positive effects of alkali therapy were not accompanied by a major reduction in tissue injury or fi- brosis, as observed by similar urinary NGAL levels, van Gieson staining quantification, pathohistological scoring, and minor effects on the expression of markers of specific subpopulations of myofibroblasts between therapeutically treated and untreated animals. Acta2 and Vim mRNA levels showed strong positive associations with Ogn and Nkd2 (respectively), markers of different subpopulations of myofibroblasts. The expression levels of Ogn and most of the other markers were not reduced by alkali therapy, suggesting that alkali therapy, at most, only had a minor role in the reduction in tubular atrophy and fibrosis. However, a lower number of Nkd positive cells might explain the reduction in Vimentin mRNA and protein levels. These data suggest that acid–base conditions may act on the differentiation of specific subpopulations of myofibroblasts.

On the 28th day after returning mice to standard diet, crystals were still visible but sparse in the renal tissue when compared with the large number of deposits on the 4th day. Alkali therapy partially cleared crystal deposits with the therapeutic treatment, which translated in a slightly less atrophied and fibrotic tissue. However, surprisingly, when comparing untreated and therapeutically treated animals with similar amounts of damaged area and crystal deposition, therapeutically treated mice showed higher creatinine and urea clearance. This strongly suggests that the largest benefit of alkali therapy in crystal nephropathy may not occur by prevention of damage or fibrosis, but rather by positive effects on healthy tissue. Most of the pathways down-regulated by crystal nephropathy and rescued by alkali therapy are involved in metabolic activities, such as fatty acid metabolic process, triglyceride lipase activity, and heme binding. These processes may support a better adaptation to reduced kidney function and enable a higher workload per nephron.

In order to further corroborate our findings in mice and to identify additional new mechanisms that may be in- volved in the positive effects of alkali therapy, we compared transcriptomics data from the mouse crystal nephropathy model with recent data from human transplant kidney biopsies from patients without acidosis, with acidosis and with acidosis and alkali therapy [19]. Importantly, human biopsies were collected under immunosuppression possibly ex- plaining why only few immune-dependent mechanisms were affected by alkali therapy. Furthermore, all patients had comparable eGFR suggesting a similar degree of renal function. Nevertheless, several important pathways are shared between human and murine kidney disease conditions that are mostly involved in cellular energy metabolism (fatty acid metabolism, transmembrane transport activity, and mitochondrial activity) as well as cell proliferations and in- tegrity (DNA repair, oxidoreductase activity) and which already appeared among the top regulated pathways in crys-

tal nephropathy. Six genes stand out being similarly regulated in mice and humans by alkali therapy: Aqp7, Selenop, Galm, Msh3, Rasd1, and Sfxn2. These genes commonly directly influence cell metabolism through activities such as glycerol transport (AQP7) [56], mitochondrial iron metabolism (SFXN2) [57], antioxidative system (SELENOP) [58],

conversion between anomers of hexose sugars (GALM) [57,59], and dexamethasone-regulated pathways (RASD1), as in adipogenesis stimulated by Insulin-like Growth Factor 1 and insulin [60,61]. Pathway analysis of the murine transcriptome data showed that alkali therapy in control animals altered similar pathways, e.g. lipid, cholesterol, and glutathione metabolic processes. Likewise, alkali therapy in crystal nephropathy modulated pathways involved in lipid, cholesterol, and iron homeostasis. Interestingly, metabolic acidosis causes mitochondrial stress and alters the redox state of mitochondrial NAD (nicotinamide adenine dinucleotide) in proximal tubules which in turn has direct impact in lipid metabolism [62,63]. The acute changes towards oxidation of NAD by acid load causes injury in prox- imal tubule cells, which is prevented by alkali supplementation [62]. Therefore, our work suggests that mechanisms altered by pure metabolic acidosis play also a similar role in a murine CKD model.




As a major limitation, we did not demonstrate to which extent oral sodium bicarbonate would correct a putative eubicarbonatemic acidosis in crystal nephropathy mice. Urine citrate has been proposed as an early marker of acid re- tention [64], but citrate levels were below the detection limit in the urine samples of all our mice. Direct measurement of tissue acidity may answer this question in the future.

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



In summary, we uncover previously unknown pathways sensitive to alkali therapy in murine and human CKD. Al- kali therapy was very effective in suppressing renal infiltration and/or local proliferation of inflammatory monocytes and CD4+ T helper cells, leading to enhanced kidney function independent of the level of fibrosis and atrophy. More- over, it rescued multiple deranged pathways involved in cell metabolism. Last, in addition to reducing ammonium excretion and circulating aldosterone levels, alkali therapy protected renal klotho levels in crystal nephropathy. Dif- ferent integrative approaches have reached similar conclusions that inflammation and metabolism are core elements for the progression of CKD [65–67]. Here, we demonstrated that alkali therapy interacts with these fundamental mechanisms and beyond previously proposed factors. Taken together, we demonstrate novel pathways activated dur- ing kidney disease and sensitive to alkali therapy and provide a rationale for further targeted approaches to these pathways.





Clinical perspectives

Correction of metabolic acidosis with bicarbonate supplementation has been shown as a low-cost and effective method to slowdown the progression of CKD. Recent clinical studies have not cor- roborated currently accepted hypotheses how alkali therapy protects kidney function.





Alkali therapy via bicarbonate supplementation protected kidney function of mice subjected to a CKD model induced by oxalate feeding. Prophylactic and therapeutic alkali therapies reduced T-helper cells and inflammatory monocyte invasion, while protecting renal klotho levels and re- stored major functions of cell metabolism. Comparison between transcriptomic data of our CKD mouse model and renal biopsies from kidney transplant patients with and without alkali therapy identified common acid–base-sensitive metabolic pathways in kidney disease.





Our work provides a novel view how alkali supplementation interacts with immune, endocrine, and metabolic pathways in kidney disease and highlights the potentiality of alkalinizing strategies to treat CKD patients.






Data Availability

All data associated with the present study are available in the main text or supplementary material. Raw RNA sequencing data are available from GEO accession GSE179216.




Competing Interests

Carsten Wagner received honoraria from the Medice C, Salmon Pharma, Chugai, and Ardelyx. Nilufar Mohebbi received speaker fees from the Mundipharma and Boehringer Ingehlheim. All other authors declare that there are no competing interests.




Funding

This work is supported by the Swiss National Science Foundation through the National Center of Competence in Research NCCR Kidney.CH. [grant number N-403-07-25 (to Pedro Henrique Imenez Silva)]; the Hartmann Mu¨ ller Stiftung [grant number 2382 (to



Pedro Henrique Imenez Silva and Carsten A. Wagner)]; work in the Joller lab was supported by the Swiss National Science Foun- dation [grant number PP00P3 181037 (to Nicole Joller)]; the European Research Council [grant number 677200 Immune Regula- tion (to Nicole Joller)]; the Swiss National Science Foundation [grant number 176125 (to Carsten A. Wagner)]; the Swiss National Science Foundation funded Preserve-Transplant Study [grant number 166811 (to Nilufar Mohebbi and Carsten A. Wagner)]




CRediT Author Contribution

Eva Mariar Pastor Arroyo: Formal analysis, Investigation, Writing—review & editing. Nima Yassini: Formal analysis, Investiga-

tion, Visualization, Methodology, Writing—review & editing. Elif Sakiri: Investigation, Writing—review & editing. Giancarlo Russo:

Conceptualization, Data curation, Formal analysis, Investigation, Writing—review & editing. Soline Bourgeois: Investigation,




Writing—review & editing. Nilufar Mohebbi: Resources, Writing—review & editing. Kerstin Amann: Formal analysis, Investiga-

tion, Writing—review & editing. Nicole Joller: Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Writing—review & editing. Carsten A. Wagner: Conceptualization, Resources, Supervision, Funding acquisition, Writing—review & editing. Pedro Henrique Imenez Silva: Conceptualization, Resources, Data curation, Formal anal- ysis, Supervision, Funding acquisition, Investigation, Visualization, Writing—original draft, Project administration, Writing—review & editing.




Acknowledgements

We thank Christian Stockmann (University of Zurich) for helpful discussions on the fibrosis data, and Maria Domenica Moccia

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



for the support with RNA sequencing (Functional Genomics Center Zurich, University of Zurich). We also would like to thank the LAMP (University of Zurich) for the histological staining and the Zurich Integrative Rodent Physiology (ZIRP, University of Zurich)

for the urine and plasma biochemical profiling. We thank Betu¨ l Haykir (University of Zurich) for the support with animal experimen- tation.




Abbreviations

CKD, chronic kidney disease; DE, differentially expressed; eGFR, estimated glomerular filtration rate; ESKD, end-stage kidney disease; FCS, fetal calf serum; GO, Gene Ontology; H&E, Hematoxylin and Eosin; IFTA, interstitial fibrosis and tubular atrophy; KTR, kidney transplant recipient; NGAL, Neutrophil gelatinase-associated lipocalin; SMA, Smooth muscle actin.




References

Levin, A., Tonelli, M., Bonventre, J. et al. (2017) Global kidney health 2017 and beyond: a roadmap for closing gaps in care, research, and policy.

Lancet North Am. Ed. 390, 1888–1917, https://doi.org/10.1016/S0140-6736(17)30788-2






Foster, B.J., Mitsnefes, M.M., Dahhou, M., Zhang, X. and Laskin, B.L. (2018) Changes in excess mortality from end stage renal disease in the United States from 1995 to 2013. Clin. J. Am. Soc. Nephrol. 13, 91–99, https://doi.org/10.2215/CJN.04330417




Wesson, D.E. and Simoni, J. (2009) Increased tissue acid mediates a progressive decline in the glomerular filtration rate of animals with reduced nephron mass. Kidney Int. 75, 929–935, https://doi.org/10.1038/ki.2009.6




Wesson, D.E., Buysse, J.M. and Bushinsky, D.A. (2020) Mechanisms of metabolic acidosis-induced kidney injury in chronic kidney disease. J. Am. Soc. Nephrol. 31, 469–482, https://doi.org/10.1681/ASN.2019070677


Madias, N.E. (2021) Metabolic acidosis and CKD progression. Clin. J. Am. Soc. Nephrol. 16, 310–312, https://doi.org/10.2215/CJN.07990520






Raphael, K.L. (2018) Metabolic acidosis and subclinical metabolic acidosis in CKD. J. Am. Soc. Nephrol. 29, 376–382, https://doi.org/10.1681/ASN.2017040422




Chen, W. and Abramowitz, M.K. (2014) Metabolic acidosis and the progression of chronic kidney disease. BMC Nephrol. 15, 55, https://doi.org/10.1186/1471-2369-15-55




Imenez Silva, P.H., Katamesh-Benabbas, C., Chan, K. et al. (2020) The proton-activated ovarian cancer G protein-coupled receptor 1 (OGR1) is responsible for renal calcium loss during acidosis. Kidney Int. 97, 920–933, https://doi.org/10.1016/j.kint.2019.12.006




Mannon, E.C. and O’Connor, P.M. (2020) Alkali supplementation as a therapeutic in chronic kidney disease: what mediates protection? Am. J. Physiol. Renal Physiol. 319, F1090–F1104, https://doi.org/10.1152/ajprenal.00343.2020


Tammaro, G., Zacchia, M., Zona, E., Zacchia, E. and Capasso, G. (2018) Acute and chronic effects of metabolic acidosis on renal function and structure.

J. Nephrol. 31, 551–559, https://doi.org/10.1007/s40620-018-0493-3






Wesson, D.E., Pruszynski, J., Cai, W. and Simoni, J. (2017) Acid retention with reduced glomerular filtration rate increases urine biomarkers of kidney and bone injury. Kidney Int. 91, 914–927, https://doi.org/10.1016/j.kint.2016.10.023




Erra D´ıaz, F., Dantas, E. and Geffner, J. (2018) Unravelling the interplay between extracellular acidosis and immune cells. Mediat. Inflamm. 2018, 1–11, https://doi.org/10.1155/2018/1218297




Nath, K.A., Hostetter, M.K. and Hostetter, T.H. (1985) Pathophysiology of chronic tubulo-interstitial disease in rats. Interactions of dietary acid load, ammonia, and complement component C3. J. Clin. Invest. 76, 667–675, https://doi.org/10.1172/JCI112020




Wesson, D.E., Jo, C.-H. and Simoni, J. (2012) Angiotensin II receptors mediate increased distal nephron acidification caused by acid retention. Kidney Int. 82, 1184–1194, https://doi.org/10.1038/ki.2012.267




Torres, V.E., Cowley, Jr, B.D., Branden, M.G., Yoshida, I. and Gattone, V.H. (2001) Long-term ammonium chloride or sodium bicarbonate treatment in two models of polycystic kidney disease. Nephron Exp. Nephrol. 9, 171–180, https://doi.org/10.1159/000052609




Gadola, L., Noboa, O., Ma´rquez, M.N. et al. (2004) Calcium citrate ameliorates the progression of chronic renal injury. Kidney Int. 65, 1224–1230, https://doi.org/10.1111/j.1523-1755.2004.00496.x




Hage, V., Villain, C., Pelletier, S., Laville, M., Drai, J. and Fouque, D. (2019) Bicarbonate supplement restores urinary klotho excretion in chronic kidney disease: a pilot study. J. Renal Nutr. 29, 285–288, https://doi.org/10.1053/j.jrn.2018.11.001


Egli-Spichtig, D., Imenez Silva, P.H., Glaudemans, B. et al. (2019) Tumor necrosis factor stimulates fibroblast growth factor 23 levels in chronic kidney disease and non-renal inflammation. Kidney Int. 96, 890–905, https://doi.org/10.1016/j.kint.2019.04.009







Imenez Silva, P.H., Wiegand, A., Daryadel, A., Russo, G., Ritter, A., Gaspert, A. et al. (2021) Acidosis and alkali therapy in patients with kidney transplant is associated with transcriptional changes and altered abundance of genes involved in cell metabolism and acid-base balance. Nephrol. Dial.

Transplant. 36 (10), 1806–1820, https://doi.org/10.1093/ndt/gfab210






Amann, K., Haas, C.S., Zeiler, G.A., Benz, K., Bader, B.L., Hartner, A. et al. (2009) Lack of nidogen-2 increases blood pressure, glomerular and tubulointerstitial damage in DOCA-salt hypertension. Eur. J. Clin. Invest. 39, 116–125, https://doi.org/10.1111/j.1365-2362.2008.02065.x




Daryadel, A., Bourgeois, S., Figueiredo, M.F.L. et al. (2016) Colocalization of the (Pro)renin receptor/Atp6ap2 with H + -ATPases in mouse kidney but prorenin does not acutely regulate intercalated Cell H + -ATPase activity. PLoS ONE 11, e0147831, https://doi.org/10.1371/journal.pone.0147831




Bolger, A.M., Lohse, M. and Usadel, B. (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120, https://doi.org/10.1093/bioinformatics/btu170




Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S. et al. (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21, https://doi.org/10.1093/bioinformatics/bts635



Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022




Lawrence, M., Huber, W., Page`s, H., Aboyoun, P., Carlson, M., Gentleman, R. et al. (2013) Software for computing and annotating genomic ranges. PLoS Comput. Biol. 9, e1003118, https://doi.org/10.1371/journal.pcbi.1003118




Robinson, M.D., McCarthy, D.J. and Smyth, G.K. (2010) edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140, https://doi.org/10.1093/bioinformatics/btp616




Young, M.D., Wakefield, M.J., Smyth, G.K. and Oshlack, A. (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 11, R14, https://doi.org/10.1186/gb-2010-11-2-r14




Mi, H., Muruganujan, A., Ebert, D., Huang, X. and Thomas, P.D. (2019) PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 47, D419–D426, https://doi.org/10.1093/nar/gky1038




Nistala, R., Meuth, A., Smith, C. and Annayya, A. (2016) Reliable and high efficiency extraction of kidney immune cells. J. Vis. Exp. 114, 54368, https://doi.org/10.3791/54368


https://www.R-project.org/R Development Core Team (2011) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria


Mulay, S.R., Kulkarni, O.P., Rupanagudi, K.V. et al. (2013) Calcium oxalate crystals induce renal inflammation by NLRP3-mediated IL-1β secretion. J.

Clin. Invest. 123, 236–246, https://doi.org/10.1172/JCI63679




Kuppe, C., Ibrahim, M.M., Kranz, J. et al. (2020) Decoding myofibroblast origins in human kidney fibrosis. Nature 1–9


Wesson, D.E. and Simoni, J. (2010) Acid retention during kidney failure induces endothelin and aldosterone production which lead to progressive GFR decline, a situation ameliorated by alkali diet. Kidney Int. 78, 1128–1135, https://doi.org/10.1038/ki.2010.348






Wesson, D.E., Simoni, J., Broglio, K. and Sheather, S. (2011) Acid retention accompanies reduced GFR in humans and increases plasma levels of endothelin and aldosterone. Am. J. Physiol. Renal Physiol. 300, F830–F837, https://doi.org/10.1152/ajprenal.00587.2010




Vallet, M., Metzger, M., Haymann, J.-P. et al. (2015) Urinary ammonia and long-term outcomes in chronic kidney disease. Kidney Int. 88, 137–145, https://doi.org/10.1038/ki.2015.52




Haruna, Y., Kashihara, N., Satoh, M., Tomita, N., Namikoshi, T., Sasaki, T. et al. (2007) Amelioration of progressive renal injury by genetic manipulation of Klotho gene. Proc. Natl. Acad. Sci. U. S. A. 104, 2331–2336, https://doi.org/10.1073/pnas.0611079104




Hu, M.C., Kuro-o, M. and Moe, O.W. (2012) Secreted klotho and chronic kidney disease. Adv. Exp. Med. Biol. 728, 126–157, https://doi.org/10.1007/978-1-4614-0887-1˙9




Leibrock, C.B., Voelkl, J., Kohlhofer, U., Quintanilla-Martinez, L., Kuro-o, M. and Lang, F. (2016) Bicarbonate-sensitive calcification and lifespan of klotho-deficient mice. Am. J. Physiol. Renal Physiol. 310, F102–F108, https://doi.org/10.1152/ajprenal.00037.2015


Zhu, L., Stein, L.R., Kim, D., Ho, K., Yu, G.-Q., Zhan, L. et al. (2018) Klotho controls the brain-immune system interface in the choroid plexus. Proc. Natl.

Acad. Sci. U.S.A. 115, E11388–E11396, https://doi.org/10.1073/pnas.1808609115






Maekawa, Y., Ishikawa, K., Yasuda, O., Oguro, R., Hanasaki, H., Kida, I. et al. (2009) Klotho suppresses TNF-α-induced expression of adhesion molecules in the endothelium and attenuates NF-κB activation. Endocrine 35, 341–346, https://doi.org/10.1007/s12020-009-9181-3




Wesson, D.E., Mathur, V., Tangri, N., Stasiv, Y., Parsell, D., Li, E. et al. (2019) Veverimer versus placebo in patients with metabolic acidosis associated with chronic kidney disease: a multicentre, randomised, double-blind, controlled, phase 3 trial. Lancet North Am. Ed. 393, 1417–1427, https://doi.org/10.1016/S0140-6736(18)32562-5




de Brito-Ashurst, I., Varagunam, M., Raftery, M.J. and Yaqoob, M.M. (2009) Bicarbonate supplementation slows progression of CKD and improves nutritional status. J. Am. Soc. Nephrol. 20, 2075–2084, https://doi.org/10.1681/ASN.2008111205




Goraya, N., Simoni, J., Jo, C.-H. and Wesson, D.E. (2014) Treatment of metabolic acidosis in patients with stage 3 chronic kidney disease with fruits and vegetables or oral bicarbonate reduces urine angiotensinogen and preserves glomerular filtration rate. Kidney Int. 86, 1031–1038, https://doi.org/10.1038/ki.2014.83




Mulay, S.R., Eberhard, J.N., Pfann, V. et al. (2016) Oxalate-induced chronic kidney disease with its uremic and cardiovascular complications in C57BL/6 mice. Am. J. Physiol. Renal Physiol. 310 (8), F785–F795, https://doi.org/10.1152/ajprenal.00488.2015


Andrade-Oliveira, V., Foresto-Neto, O., Watanabe, I.K.M., Zatz, R. and Caˆmara, N.O.S. (2019) Inflammation in renal diseases: new and old players. Front.

Pharmacol. 10, 1192, https://doi.org/10.3389/fphar.2019.01192






Mulay, S.R. and Anders, H.-J. (2017) Crystal nephropathies: mechanisms of crystal-induced kidney injury. Nat. Rev. Nephrol. 13, 226–240, https://doi.org/10.1038/nrneph.2017.10


Cochat, P., Hulton, S.-A., Acquaviva, C. et al. (2012) Primary hyperoxaluria Type 1: indications for screening and guidance for diagnosis and treatment.

Nephrol. Dial. Transplant. 27, 1729–1736, https://doi.org/10.1093/ndt/gfs078






D’Ambrosio, V., Capolongo, G., Goldfarb, D., Gambaro, G. and Ferraro, P.M. (2021) Cystinuria: an update on pathophysiology, genetics, and clinical management. Pediatr. Nephrol., Online ahead of print, https://doi.org/10.1007/s00467-021-05342-y





Nath, K.A., Hostetter, M.K. and Hostetter, T.H. (1991) Increased ammoniagenesis as a determinant of progressive renal injury. Am. J. Kidney Dis. 17, 654–657, https://doi.org/10.1016/S0272-6386(12)80344-1






Bove´e, D.M., Roksnoer, L.C.W., van Kooten, C., Rotmans, J.I., Vogt, L., de Borst, M.H. et al. (2020) Effect of sodium bicarbonate supplementation on the renin-angiotensin system in patients with chronic kidney disease and acidosis: a randomized clinical trial. J. Nephrol. 34 (5), 1737–1745, https://doi.org/10.1007/s40620-020-00944-5




Ray, S.C., Baban, B., Tucker, M.A. et al. (2018) Oral NaHCO3 activates a splenic anti-inflammatory pathway: evidence that cholinergic signals are transmitted via mesothelial cells. J. Immunol. 200, 3568–3586, https://doi.org/10.4049/jimmunol.1701605




Chen, A., Dong, L., Leffler, N.R., Asch, A.S., Witte, O.N. and Yang, L.V. (2011) Activation of GPR4 by Acidosis Increases endothelial cell adhesion through the cAMP/Epac pathway. PLoS ONE 6, e27586, https://doi.org/10.1371/journal.pone.0027586




Dong, L., Li, Z., Leffler, N.R., Asch, A.S., Chi, J.-T. and Yang, L.V. (2013) Acidosis activation of the proton-sensing GPR4 receptor stimulates vascular endothelial cell inflammatory responses revealed by transcriptome analysis. PLoS ONE 8, e61991, https://doi.org/10.1371/journal.pone.0061991


de Vallie`re, C., Wang, Y., Eloranta, J.J. et al. (2015) G protein-coupled pH-sensing receptor OGR1 is a regulator of intestinal inflammation. Inflamm.

Downloaded from http://portlandpress.com/clinsci/article-pdf/136/8/557/932006/cs-2022-0095.pdf by Universitat Zurich user on 05 August 2022



Bowel Dis. 21, 1269–1281, https://doi.org/10.1097/MIB.0000000000000375






Wang, Y., de Vallie`re, C., Silva, I. et al. (2018) The proton-activated receptor GPR4 modulates intestinal inflammation. J. Crohns Colitis 12, 355–368, https://doi.org/10.1093/ecco-jcc/jjx147




Leibrock, C.B., Alesutan, I., Voelkl, J., Pakladok, T., Michael, D., Schleicher, E. et al. (2015) NH4Cl treatment prevents tissue calcification in klotho deficiency. J. Am. Soc. Nephrol. 26, 2423–2433, https://doi.org/10.1681/ASN.2014030230




Sohara, E., Rai, T., Miyazaki, J., Verkman, A.S., Sasaki, S. and Uchida, S. (2005) Defective water and glycerol transport in the proximal tubules of AQP7 knockout mice. Am. J. Physiol. Renal Physiol. 289, F1195–F1200, https://doi.org/10.1152/ajprenal.00133.2005


Mon, E.E., Wei, F.-Y., Ahmad, R.N.R., Yamamoto, T., Moroishi, T. and Tomizawa, K. (2019) Regulation of mitochondrial iron homeostasis by sideroflexin

2. J. Physiol. Sci. 69, 359–373, https://doi.org/10.1007/s12576-018-0652-2






Mita, Y., Nakayama, K., Inari, S. et al. (2017) Selenoprotein P-neutralizing antibodies improve insulin secretion and glucose sensitivity in type 2 diabetes mouse models. Nat. Commun. 8, 1658, https://doi.org/10.1038/s41467-017-01863-z




Timson, D.J. and Reece, R.J. (2003) Identification and characterisation of human aldose 1-epimerase. FEBS Lett. 543, 21–24, https://doi.org/10.1016/S0014-5793(03)00364-8




Kim, H.J., Cha, J.Y., Seok, J.W. et al. (2016) Dexras1 links glucocorticoids to insulin-like growth factor-1 signaling in adipogenesis. Sci. Rep. 6, 28648, https://doi.org/10.1038/srep28648




Tan, J.J., Ong, S.A. and Chen, K.-S. (2011) Rasd1 interacts with Ear2 (Nr2f6) to regulate renin transcription. BMC Mol. Biol. 12, 4, https://doi.org/10.1186/1471-2199-12-4




Bugarski, M., Ghazi, S., Polesel, M., Martins, J.R. and Hall, A.M. (2021) Changes in NAD and lipid metabolism drive acidosis-induced acute kidney injury. J. Am. Soc. Nephrol. 32, 342–356, https://doi.org/10.1681/ASN.2020071003


Namba, T., Takabatake, Y., Kimura, T. et al. (2014) Autophagic clearance of mitochondria in the kidney copes with metabolic acidosis. J. Am. Soc.

Nephrol. 25, 2254–2266, https://doi.org/10.1681/ASN.2013090986






Goraya, N., Simoni, J., Sager, L.N., Madias, N.E. and Wesson, D.E. (2019) Urine citrate excretion as a marker of acid retention in patients with chronic kidney disease without overt metabolic acidosis. Kidney Int. 95, 1190–1196, https://doi.org/10.1016/j.kint.2018.11.033


Eddy, S., Mariani, L.H. and Kretzler, M. (2020) Integrated multi-omics approaches to improve classification of chronic kidney disease. Nat. Rev. Nephrol.

16, 657–668, https://doi.org/10.1038/s41581-020-0286-5




Kang, H.M., Ahn, S.H., Choi, P. et al. (2015) Defective fatty acid oxidation in renal tubular epithelial cells plays a key role in kidney fibrosis development.

Nat. Med. 21, 37–46, https://doi.org/10.1038/nm.3762






Martini, S., Nair, V., Keller, B.J. et al. (2014) Integrative biology identifies shared transcriptional networks in CKD. J. Am. Soc. Nephrol. 25, 2559–2572, https://doi.org/10.1681/ASN.2013080906